Biology mural at James Madison University
769
25
0
Add to Collection
Tools Used

Tools

About

About

A three-story mural of DNA, plants, animals, and other organisms, for the new Biology building at James Madison University.
Published:
Biology Mural
for James Madison University
I recently completed a three-story mural for the new Biology building at James Madison University.  I drew about 20 organisms to surround the large strand of DNA, which is based on a 3-D model rendered in Chimera.
The mural spans three panels
3rd floor, 24’8″w x 10’9″h
2nd floor, 24’4″w x 10’8″h
1st floor, 14’8″w x 10’7″h
My design was printed onto adhesive panels and installed on the wall. When the mural is seen through the 3-story glass exterior wall of the building, the panels will appear to connect as one image. Close-ups of some drawings, as well as in-situ views shown below.

Building photos by Jon Monroe
’m>

The DNA image was based on the sequence CTCCCTTTGGATGGTCTGTGGATTGACATGAATGAGTTAT
CAAATTTCATAACTTCGCGT