DYNAMIC LIGHTING
Collaborative project
ATGTCTGCAAATAGCACCATAACTCGGGAATAG - PROGRAMA
Collaborative project
ATGTCTGCAAATAGCACCATAACTCGGGAATAG - PROGRAMA
Caras y Caretas Theater, Buenos Aires (2017)
MUSIC & PERFORMANCE / Programa
PROGRAMMING / Alejandra Aguirre
ART DIRECTION + LIGHTING DESIGN (c4d Animations) / Diego Rampelini
Development of an interactive system for dynamic scene lighting, linking MIDI, DMX512 signals and Cinema 4D animations.
PROGRAMMING / Alejandra Aguirre
ART DIRECTION + LIGHTING DESIGN (c4d Animations) / Diego Rampelini
Development of an interactive system for dynamic scene lighting, linking MIDI, DMX512 signals and Cinema 4D animations.
PROCESO / Process
Cinema 4D
Se diseñan las escenas lumínicas en Cinema 4D
Cinema 4D
Cinema 4D
The lighting scenes are designed in Cinema 4D
Cinema 4D Xpresso
Mediante C4D Xpresso, las animaciones se representan como valores de luminancia en una grilla específica para cada equipo de iluminación, que se exporta como una secuencia de imágenes.
Cinema 4D Xpresso
Using C4D Xpresso, the animations are represented as luminance values in a specific grid for each lighting equipment, which is exported as a sequence of images.
Cinema 4D Xpresso
Using C4D Xpresso, the animations are represented as luminance values in a specific grid for each lighting equipment, which is exported as a sequence of images.
Patronale
Software desarrollado en Openframeworks
Software desarrollado en Openframeworks
Interpreta secuencias de imágenes y fórmulas matemáticas generando un archivo de texto (“preset”) con un listado de valores 0-255 específico de cada animación.
Patronale
Software developed in Openframeworks
Interprets sequences of images and mathematical formulas generating a text file ("preset") with a list of values 0-255 specific to each animation.
Patronale
Software developed in Openframeworks
Interprets sequences of images and mathematical formulas generating a text file ("preset") with a list of values 0-255 specific to each animation.
Lumière
Software desarrollado en Openframeworks
Software desarrollado en Openframeworks
Permite el control de equipos de iluminación a través de una interfaz USB-DMX.
Genera patrones de movimiento/color/intensidad que pueden ser modificados en tiempo real utilizando controladores MIDI.
Los patrones se generan a partir de fórmulas matemáticas y de presets generados con Patronale.
Muestra una visualización de la planta, del movimiento de los equipos y de la información procesada.
Lumière
Lumière
Software developed in Openframeworks
It allows the control of lighting equipment through a USB-DMX interface.
Generates motion / color / intensity patterns that can be modified in real time using MIDI controllers.
The patterns are generated from mathematical formulas and presets generated with Patronale.
It shows a visualization of the plant, the movement of the equipment and the processed information.
It allows the control of lighting equipment through a USB-DMX interface.
Generates motion / color / intensity patterns that can be modified in real time using MIDI controllers.
The patterns are generated from mathematical formulas and presets generated with Patronale.
It shows a visualization of the plant, the movement of the equipment and the processed information.
Hardware
Enttec DMX USB PRO Mk2
Novation LaunchControlXL
Korg Electribe Sampler 2
Equipamiento lumínico: Cabezales Móviles Robin Pointe, Par LED
Macbook Pro
Software
C4D / C4D Xpresso
Patronale (Openframeworks)
Lumière (Openframeworks)